Huntington disease – causes, symptoms, diagnosis, treatment & pathology

42 comments

  1. My high school sweetheart, my first and forever love was taken from me with Huntingtons Desease. I am shattered. Heart broken forever. Sending my love to all affected by this horrific desease . You are all warriors. Bless you all. 😢

  2. Please guide me difference between Chorea and Huntington ..Dr told us that my nephew has chorea ..but he is normal so far his age is 14. He only moves his shoulders. What about his future ? Feeling worry….

  3. DNA Polymerase: cagcagcagcacagcagcagcagcagcagcagcagcag bruh sooo many cag's can i quitHuntington DNA: sorry but no we have a job to do DNA Polymerase: ummmm… i don't know how much to got is it ok if i do more than normal??Huntington DNA: ok, … wait didn't you want to quitDNA Polymerase: ok nvm about that just do your thing im done now… Huntington's DNA: ohkay bye…

  4. 😭😭😭😭sad,,my x BF from saudi had this 😭😭no one knows except me😭😭his dad died at age of 45 and her sister is suffering now😭😭😭 my x bf now his 34 yrs old and I don't know Whr is he now coz we broke up without closure 😭😭😭😭😭😭

  5. and my bad I have to start making more logical plans to help my sister. yeah its overwhelming to think for every person in my family. it would be simple to just go get tested but we don't in my family we wait to the last min and by then its years to late to solve the money problem. you see a joking guy. cause its what I show you. I don't want you to really know my thoughts cause its not your business

  6. My mum has Huntington’s disease it is a genitic disease that cannot skip a generation so me or my bro will get it

  7. Thank you for making this video, it really helped me understand the disease for my research report. But I just have a question that since this disease is much related to Parkinson's in the abnormal, uncontrollable movements, doesn't that mean it can be treated with medical cannibis. Because it can only be suppressed by sleep, but if the symptoms are similar to parkinstons, wouldn't there be a possibility of treating it with cannibis?

  8. My mum has this disease… It's a small chance I might have it though… 🙁 The only good thing is my dad's genes take up most my body, so it's high chance I won't have it. When mum gets close to me, I tell her to get back so I don't get the disease. I also have questions: Is there a symptom of stammering from this? Is it normal for this to cause them to cough a lot? Is it normal for their voices to stammer? High blood sugar?
    I just pray I don't have the disease… 🙁
    Edit: I'm 11 also. :/

  9. I got my blood drawn 2 days ago. Waiting 3-4 weeks to know the results. Wish everyone best of luck. Take care. -San Francisco, California

  10. I might be mistaken, but at 1.52 shouldn't it be the other way around? I mean HTT's sequence is CAGCAG etc. Then shouldn't the DNA Polymerase translate it from the CAG sequence into the GTC sequence?

Leave a Reply

(*) Required, Your email will not be published